A rapid and efficient method for mutagenesis with OE PCR.pdf

Appl Microbiol Biotechnol (2005) 68: 774

–

778

DOI 10.1007/s00253-005-1948-8

APPLIED GENETICS AND MOLECULAR BIOTECHNOLOGY

Yingfeng An . Jianfei Ji . Wenfang Wu . Anguo Lv .

Ribo Huang . Yutuo Wei

A rapid and efficient method for multiple-site mutagenesis

with a modified overlap extension PCR

Received: 3 February 2005 / Revised: 20 February 2005 / Accepted: 22 February 2005 / Published online: 14 June 2005

Abstract A rapid and efficient method to perform site-

directed mutagenesis based on an improved version of

overlap extension by polymerase chain reaction (OE-PCR)

is demonstrated in this paper. For this method, which we

name modified (M)OE-PCR, there are five steps: (1)

synthesis of individual DNA fragments of interest (with

average 20-bp overlap between adjacent fragments) by

PCR with high-fidelity pfu DNA polymerase, (2) double-

mixing (every two adjacent fragments are mixed to im-

plement OE-PCR without primers), (3) pre-extension (the

teams above are mixed to obtain full-length reassembled

DNA by OE-PCR without primers), (4) synthesis of the

entire DNA of interest by PCR with outermost primers and

template DNA from step 3, (5) post-extension (ten cycles

of PCR at 72°C for annealing and extension are im-

plemented). The method is rapid, simple and error-free. It

provides an efficient choice, especially for multiple-site

mutagenesis of DNAs; and it can theoretically be applied to

the modification of any DNA fragment. Using the MOE-

PCR method, we have successfully obtained a modified

sam1 gene with eight rare codons optimized simultaneously.

Introduction

Site-specific mutagenesis of DNA is a very important tool

in genetic engineering. Changing the DNA sequence can

facilitate the study of the structure – function relationships

of DNA, RNA, or protein coded by the DNA sequence. A

variety of methods have been applied for the introduction

of specific bases changes at predetermined sites in DNA

sequences (Higuchi et al. 1988 ; Warrens et al. 1997 ; Chiu

et al. 2004 ; Allemandou et al. 2003 ; Rabhi et al. 2004 ;

Tyagi et al. 2004 ; Li et al. 2004 ; Kirsch and Joly 1998 ;

Kegler-Ebo et al. 1994 ; Zoller and Smith 1982 ), the most

powerful among which is overlap extension by polymerase

chain reaction (OE-PCR), described by Higuchi et al.

( 1988 ). In some cases, it is desirable to introduce multiple

different substitutions at a particular position or at several

positions in a gene and to determine the consequences

of these changes on protein function or to optimize the

expression. However, traditional OE-PCR can introduce

mutations at only one site at a time; and efficiencies drop

drastically when a few sites are targeted simultaneously.

We have developed a rapid, efficient and high-fidelity

modification (M) of OE-PCR (i.e. MOE-PCR) which al-

lows one to generate multiple site-directed mutations in a

given DNA fragment synchronously. The method has been

successfully implemented to optimize eight rare codons in

the sam1 gene (ID 850877); and no unexpected mutagen-

esis was detected.

Electronic Supplementary Material Supplementary material

is available for this article at http://dx.doi.org/10.1007/s00253-005-

1948-8.

Y. An . W. Wu ( * ) . A. Lv

Institute of Applied Ecology,

Chinese Academy of Sciences,

Shenyang, China

e-mail: wshr100@sina.com

Y. An

Graduate School of Chinese Academy of Sciences,

Beijing, China

J. Ji

Beckman Research Institute,

City of Hope National Medical Center,

Duarte, USA

R. Huang . Y. We i

Laboratory of Protein Engineering,

College of Life Science & Technology,

Guangxi University,

Guangxi, China

Materials and methods

Materials

Chemicals, high-fidelity pfu DNA polymerase, T4 DNA

ligase, DL2000 DNA marker and restriction endonucleases

Springer-Verlag 2005

775

were purchased from Takara Co. (Dalian, China). Vector

pYES2, host strain Escherichia coli JM109 and Saccha-

romyces cerevisiae INVScI (products of Invitrogen Corp.)

were presented by the Laboratory of Protein Engineering,

Guangxi University. Oligonucleotide primers were synthe-

sized and purified by Sangon Co. (Shanghai, China). The

PCR purification kit and gel extraction kit were purchased

from Watson Biotechnologies (Shanghai, China); and the

DNA sequencing was performed by Takara Co. (Dalian,

China).

The five steps in the reaction process were as follows.

l. The

reaction programs include 15 cycles of PCR without prim-

ers. Denaturation was at 94°C for 20 s, with various an-

nealing and extension conditions: 59.6°C for 1 min 25 s for

fragments 1, 2, 58.8°C for 1 min 25 s for fragments 2, 3,

58.8°C for 1 min 20 s for fragments 3, 4, 55.1°C for 1 min

20 s for fragments 4, 5 and 53.3°C for 55 s for fragments

5, 6.

mol of each dNTP in a final volume of 20

Step 3

Step 1

l of every product from step 2 were mixed

together to perform 20 cycles of 94°C for 20 s, 72°C for

30 s without primers.

Six parallel PCR reactions were performed to amplify each

DNA fragment, with 5 units of pfu DNA polymerase and

1× buffer in the presence of 200

M dNTP, 1 mmol of each

primer (Table 1 ) and 10 ng of S. cerevisiae genomic DNA

in a final volume of 100

l. The PCR reaction programs

were optimized respectively as follows: 94°C for 2 min,

then 30 cycles of 94°C for 30 s for denaturation, 59.6°C for

30 s and 72° for 55 s, followed by 72°C for 10 min for

fragment 1; and the reaction conditions for the other frag-

ments were similar, except for the annealing temperature

and extension time. The annealing temperatures used for

fragments 2

Step 4

To add both outer primers (40 pmol for each) to the reaction

system, PCR was implemented as follows: 94°C for 20 s,

then 30 cycles of 94°C for 20 s, 53.3°C for 30 s and 72°C

for 2 min.

6 were 62.5, 58.8, 59.5, 55.1 and 53.3°C,

respectively; and the extension times used for fragments

–

Step 5

6 were 1 min 25 s, 55 s, 1 min 20 s, 50 s and 55 s,

respectively. Amplified products were loaded on a 1% aga-

rose electrophoresis gel and purified by a gel extraction kit.

Ten additional cycles of 94°C for 30 s and 72°C for 1 min

were implemented.

Step 2

Comparisons omitting steps 2,3, 5

The following reactions were divided into five teams and,

in each team, equimolar aliquots of every two adjacent

As comparisons, processes without steps 2, 3 or 5 were

implemented, respectively. The PCR product was subjected

Table 1 The mutagenic primers

used for optimizing rare

codons in sam1 with MOE-PCR

Frag-

ments

Primers

Sequences for primers (listed 5’to3’)

Bases

substitute

F 0

ATT GGATCC CAACGATGGCACTAGACATA

-------

AGCGGTTTCACAAGCAACTTTGGAGTG

C to A

GCTTGTGAAACCGCTGCAAAGACTGGTAT

G to T

AGCTAAAGAGCCATCTCTTCTAGCGTCAGCCATG

C to A

GCTAGAAGAGATGGCTCTTTAGCTTGGTTGAGACC

G to T

AGCTCTTAAGTCCTCGGTAGTGATTTCGTCAGC

C to A

ACTACCGAGGACTTAAGAGCTCAACTAAAGTCC

G to T

CAATGGTTCAGCAATACCGATGGC

C to A

ATGCCATCGGTATTGCTGAACCATTGTCC

G to T

The bases for substitutions were

shadowed. The restriction sites

for Bam HI and Eco RI were

in boxes

GTCAGACTTGGTAGCAGTACCATAGGTGTCAAC

C to A

ACCTA TGGTAC TGCTACCAAGTCTGACGAAG

G to T

R 0

GCA GAATTC GAGGTTGAAGGCAGAAAA

------

DNA fragments (10 ng for each) above were mixed in the

presence of 1 unit of pfu DNA polymerase, 1× buffer,

200

Next, 20

–

776

Fig. 1 One percent agarose

electrophoresis gel showing

eight site substitutions in sam1

by MOE-PCR. Lane M DNA

size marker DL2000, lanes 1 – 6

fragments 1 – 6 synthesized by

PCR, lane 7 extension of the

target DNA by PCR with out-

ermost primers and template

DNA from step 3

to agarose gel electrophoresis and the desired bound was

then excised and purified with the gel extraction kit. The

purified DNA was subjected to Bam HI and Eco RI diges-

tion and cloned into similarly digested pYES2 vector, ac-

cording to standard procedures (Sambrook et al. 1989 ). The

recombinant plasmid was transformed into E. coli JM109;

and recombined vector was extracted and sequenced to

verify the accurate mutations.

sequences analyzed; and all the rare codons were optimized

properly without additional mutations introduced (Supple-

mentary Material, Appendix 1).

Discussion

Compared with OE-PCR for site-directed mutagenesis,

MOE-PCR (Fig. 2 ) has some apparent advantages, one of

which is that, when multiple-site mutations are implemen-

ted, relative fewer PCR cycles are required for MOE-PCR.

As for the present research, eight sites were mutated and a

total of 255 cycles of PCR reaction were implemented,

including 180 cycles for fragment synthesis (30 cycles for

each fragment), 15 cycles for double-mixing, 20 cycles

pre-extension, 30 cycles for PCR extension and 10 cycles

Results

We successfully applied MOE-PCR to introduce eight

codon-substitutions into the DNA of sam1 . After a round

of reassembly and extension, DNA of the desired size was

obtained (Fig. 1 ). DNA was cloned into the vector and the

Fig. 2 The use of MOE-PCR

for eight site-substitutions in

sam1 . a Synthesis of DNA

fragments by PCR, gray bars

represent substitution sites.

b Double-mixing: every two

adjacent fragments are mixed to

implement OE-PCR without

primers. c Pre-extension: the

teams above are mixed to obtain

full-length reassembled DNA by

OE-PCR without primers.

d Synthesis of the entire DNA

of interest by PCR with outer-

most primers and template DNA

from step3 (c). e Post-extension:

ten cycles of PCR with 72°C for

annealing and extension are

implemented

777

post-extension. If OE-PCR was used, not less than 540

cycles would be needed for an eight-codon optimization

(within six fragments), because three fragments (including

a full-length DNA) need to be synthesized by PCR within

each round of the reaction; and six rounds for the whole

process (30 cycles for every round) are necessary tradi-

tionally. Additionally, only seven fragments need be pu-

rified in MOE-PCR, because no purification is needed after

steps 2, 3 and 4, while if OE-PCR was implemented,

purification would be necessary after every step and 18

fragments as a whole would be purified, respectively. Ad-

ditionally, to ensure efficient and error-free extension, every

program for PCR must be optimized, so for OE-PCR, 21

program-optimizations are needed, while MOE-PCR re-

quires only nine (pre-extension, post-extension programs

fixed for 94°C denaturation, 72°C annealing, extension). To

sum up, it is obviously more efficient and time-saving for

the application of MOE-PCR.

Through comparison, the necessity of pre-extension was

verified since, without it, only the dispersed band was ob-

tained through electrophoresis. Through alignment anal-

ysis between DNA fragments synthesized in step 1 with

Vector NT software, the results show that there were ob-

vious identity (average 40%) between every two of the

fragments (Supplementary Material, Appendix 2). As a re-

sult, when all the fragments are mixed together directly, the

multiple fragments interrupt each other for correct overlap.

To avoid this trouble, double-mixing was implemented.

When only two fragments were mixed and overlap-ex-

tended, the reaction component was relatively simple and

the interruption was minimized. More importantly, the gen-

eration of longer identical ends between adjacent fragments

in this step facilitated the overlap extension in the following

step.

In the pre-extension, owing to the long overlap regions

generated between newly extended fragments, a higher

temperature (72°C) was applied for the annealing and ex-

tension process, which was the optimized temperature for

pfu DNA polymerase. At the same time, a higher tem-

perature also decreases the possibility of any mismatch.

We also tested the necessity of PCR without primers,

after which reassembly was possible, while it was un-

available when primers were added directly to the mixture

of fragments (i.e. without steps 2, 3). This result affords

some thought, because theoretically the fragment overlap-

extensions and PCR with primers can occur simultaneously

in a reaction system and there seems to be no substantial

difference between the two treatments, except for that some

full-length templates are generated after PCR without

primers. Therefore, the prepared full-length template may

be essential for PCR in addition to overlapped fragments.

Although uncertain, the disturbance of template generation

by primers may be crucial for this result. Because the ratio

of primer to template is 10 6 in the PCR system, which

means that every molecular DNA fragment was enveloped

with 10 6 primers, the spatial obstruction by primers could

encumber the annealing process between the fragment ends

and thus restrain the generation of full-length templates.

This was especially the case when multiple-step overlaps

and extension with multiple DNA fragments were im-

plemented. Additionally, after steps 2 and 3, the full-length

template was ready for the exponential extension of the

desired DNA, while the template needed to be reassembled

and accumulated for preliminary cycles in the absence of

PCR without primers, which could be another factor to be

mentioned.

The necessary of post-extension was also tested for ob-

taining the reassembled DNA; and only a disperse band

was obtained without post-extension (data not shown).

After reassembly by PCR, there existed both remnant and

incompletely extended DNA fragments; and such frag-

ments had to be minimized, because the annealing of large

amounts of these fragments to full-length single-strand-

ed DNA (generated during denaturation) would give less

chance for the generation of the target double-stranded

DNA (dsDNA). As a result, distinct dsDNA cannot be de-

tected, although it is available in theory; and this was the

case especially when multiple original fragments were used

for reassembly. In the post-extension process, 72°C was

used for annealing and extension, which was higher than

the annealing temperatures of both primers. At 72°C, the

DNA recombining by overlap and extension of fragments

should induce full-length DNAs to be generated, accom-

panied by a decrease in DNA fragments, but the synthesis

of new DNA fragments by primers is avoided. The con-

ditions for the above steps were optimized and all the re-

action processes were repeated to attest the recurrence.

In summary, the MOE-PCR method we have demon-

strated here allows the rapid and efficient introduction of

multiple mutations into DNA. Although multiple-site mu-

tagenesis is also available using older methods, those pro-

cesses are tedious and time-consuming, while the method

presented here minimizes the process of multiple-site mu-

tagenesis with error-free results, which is an important im-

provement; and it can be widely applied wherever gene

substitutions, deletions or insertions in different sites are

needed, including the protein pharmaceutical industry, ag-

riculture, chemical industry, biotechnology, etc., especially

for enzyme engineering.

Acknowledgements The authors thank Frances H. Arnold for data

and Han Siqin, Xu Mei and Ni Jianfeng for helpful discussion and

technical assistances. We are grateful to the Laboratory of Protein

Engineering, Guangxi University for technical support.

References

Allemandou F, Nussberger J, Brunner HR, Brakch N (2003) Rapid

site-directed mutagenesis using two-PCR-generated DNA frag-

ments reproducing the plasmid template. J Biomed Biotechnol

2003:202 – 207

Chiu J, March PE, Lee R, Tillett D (2004) Site-directed, ligase-

independent mutagenesis (SLIM): a single-tube methodology

approaching 100% efficiency in 4 h. Nucleic Acids Res 32:

e174

Higuchi R, Krummel B, Saiki RK (1988) A general method of in

vitro preparation and specific mutagenesis of DNA fragments:

study of protein and DNA interactions. Nucleic Acids Res 16:

7351 – 7367

778

Kegler-Ebo DM, Docktor CM, DiMaio D (1994) Codon cassette

mutagenesis: a general method to insert or replace individual

codons by using universal mutagenic cassettes. Nucleic Acids

Res 22:1593 – 1599

Kirsch RD, Joly E (1998) An improved PCR-mutagenesis strategy

for two-site mutagenesis or sequence swapping between related

genes. Nucleic Acids Res 26:1848 – 1850

Li CH, Fang HY, Deng XY, Xia K, Zheng D, Xia JH (2004)

Construction of middle fragment deletion mutant with im-

proved gene splicing by overlap extension. Zhonghua Yixue Yi

Chuan Xue Zazhi 21:52 – 55

Rabhi I, Guedel N, Chouk I, Zerria K, Barbouche MR, Dellagi K,

Fathallah DM (2004) A novel simple and rapid PCR-based site-

directed mutagenesis method. Mol Biotechnol 26:27 – 34

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a

laboratory manual. Cold Spring Harbor Laboratory, Cold

Spring Harbor, N.Y.

Tyagi R, Lai R, Duggleby RG (2004) A new approach to

‘ megaprimer ’ polymerase chain reaction mutagenesis without

an intermediate gel purification step. BMC Biotechnol 4:2

Urban A, Neukirchen S, Jaeger KE (1997) A rapid and efficient

method for site-directed mutagenesis using one-step overlap

extension PCR. Nucleic Acids Res 25:2227 – 2228

Warrens AN, Jones MD, Lechler RI (1997) Splicing by overlap

extension by PCR using asymmetric amplification: an im-

proved technique for the generation of hybrid proteins of

immunological interest. Gene 186:29 – 35

Zoller MJ, Smith M (1982) Oligonucleotide-directed mutagenesis

using M13-derived vectors: an efficient and general procedure

for the production of point mutations in any fragment of DNA.

Nucleic Acids Res 10:6487 – 6500

Plik z chomika:

Inne pliki z tego folderu:

Inne foldery tego chomika: